Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:330D9   

TH:330D9RNAiTH:330D9
PCR_productTH:330D9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC48B4.7 Source_evidenceePCR469WS150 Sequence/Annotation Release
Overlaps_Gene C48B4.7 Source_evidenceePCR469WS150 Sequence/Annotation Release
Chunk_score Abs_score385
Max_abs_score385C48B4.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII95587119559674
Overlaps_transcriptC48B4.7 Source_evidenceePCR469WS150 Sequence/Annotation Release
WB_DNA_textTH:330D9964tgatagtgaagcggggaagaatcaatctcgactttgcgactctgatgagttggaggcacatccagatgtagaaaatgacggctgaaacgatacattttgttttcaattactgcattttaaattcttatttaccaaacaaaattgcggtgatcttcatgaaatctttcgcatcgcgtgaagtggcattttcttcgatgaacagtttgtctgaaaggccacgaatttaggattttgaataaagtttttgaaaacttactacagagactgatgagcttcatgatgaaaacgacagccggccagatgagcaaaatgcatgagacatagtaatggatggccatcatggtcccatattcgccaaggaatgcaacaaaggaagagatagtaaagacgagctgaagattaatttaaattaagaaattaaacaataatttttaccaagagaaccatcgcaacgaaaacgatttcttcctgatttccattatagtagagcatgcaaaattggatcacgatagcaataagctggacgagaagaaccgcgagcttgatcgggaagaatccacagagcaatggagagttcaagctgcagagaggacgcgtctcgaaatgtgtcatttctgaaaaacatgaaaactgaattaattcatataaataaaatcgaaatttaatggaagttcgaaattattcagaaaaaaatcttaacaacgaactgaaatccgttgaatttggaattaaaaataaagaaaacaatatgtttgacctaaaacggtaaatgtttttcccaaaacgaaaacaaacattttgtctcttcaaaaccaaaaaatgagaatcgtcgtgcgcctttaaggattctcgcttcgagacccggccgattatttggcttgtgttcctttaatttctacagtaacgataaagattgaagatttttatttttagctggtttcttcgtttttcttcgtgttttcgg