Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:330F1   

TH:330F1RNAiTH:330F1
PCR_productTH:330F1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26A5.8 Source_evidenceePCR414WS150 Sequence/Annotation Release
Overlaps_Gene T26A5.8 Source_evidenceePCR453WS150 Sequence/Annotation Release
Chunk_score Abs_score390
Max_abs_score390T26A5.8
Specificity_index0.749
Rel_score1
Map_statusBest_ePCRIII64622356462973
T26A5.9 Source_evidenceePCR132WS150 Sequence/Annotation Release
Chunk_score Abs_score131
Specificity_index0.251
Rel_score0.336
Map_statusBottom50_percentile_ePCRIII64622356462973
Overlaps_transcript T26A5.9.2 Source_evidenceePCR132WS150 Sequence/Annotation Release
T26A5.8 Source_evidenceePCR453WS150 Sequence/Annotation Release
T26A5.9.1 Source_evidenceePCR130WS150 Sequence/Annotation Release
WB_DNA_textTH:330F1739aaggatcgttttgagcaggaatgagttggttatgagtgatcagttcatcaatgaatctgcaatattataaattattcagataaacttcagatttaaagaatagaactaaccatcgacaggagtatcgtcaataatgtcgtcatccatttcagcattgacagagctggattcaactggatttttacgagcgagagccttctgctgactaataactttccatttatcgttggcggacttgcactggaaattttaatttcttaactctttcgaaacccataattacatgattgtgaatagaagtattctcaagctctcggagtcctttgacaacatcatctcctgagatcgtcttgtgcttctgatcgcgagcagattgagccgaaacgtcggacaagtttatgagaaacactgctgcagcacgagcgatgacgtctcgagcatcttttgatgcagaaatattgtcttctttcatgagccgagtcacaattgctgctggcatcatcatttgagcaattcgatcatcgttttgatccacatcgtttgatgacatttctatcttaaattattgccttgttcagtttcgagtataaaaatgaagcacagataattaagggatttaaagctatccttttatttttacttttagtgcgagcacttttcgagaacaaaaatattatgagttctcttttctctcaaaaacggacaacgtaagaagatttatgggtgatggaggaagatt