Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:330H10   

TH:330H10RNAiTH:330H10
PCR_productTH:330H10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK525.1 Source_evidenceePCR200WS150 Sequence/Annotation Release
Overlaps_Gene ZK525.1 Source_evidenceePCR227WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII1366303713663813
Overlaps_transcriptZK525.1 Source_evidenceePCR227WS150 Sequence/Annotation Release
WB_DNA_textTH:330H10777caagaaaatgaccgctctccaaattatttactggtaccacgacgcgacgtcttcagcagcaggtgccacgtggaatgatgatcgctttccaaaacggagaggtccagatggtccacgtcgttttccgaatcgaagtggtccctggggtccgcctttctttacgtctgaaaatttagcataaagtggtcaccaaacataaaaaaattggtaggttaaaaagcaatcaaaccgtttgagatataaaaaagttttaactgaaaatagatagaaaacttatttgttataaatgtttttaaaagtattaattttcaaaatggtattctcacttgaattcagcgataaaatgtatttctgaacattttttgaaatgctgatatctttttagaaacttaagagatcgaaaagttttgaataaacaaatgttttaaaactttgtgattttcattttttaagttaacaattcaaaagcttacaattggaaaagtagtccaaatcaacagccactgggattgttccgaccgaattgtcgtcgtaatctgcaattttagaatgcttgttttttttttgaaattttggttcatttgaaagtcatagtttgagcttttaattactacttattagtttttaattcccattgttccaatcttggaaatatcaaattccttctgaatcctttcaagtttatttataaagtgacgttttttttttctcattttccactttctaaatatttgtttaaaattcacaaaaattctcacatgaaacccacttccgaca