Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:331B2   

TH:331B2RNAiTH:331B2
PCR_productTH:331B2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R144.12 Source_evidenceePCR493WS150 Sequence/Annotation Release
R144.6 Source_evidenceePCR612WS150 Sequence/Annotation Release
Overlaps_Gene R144.12 Source_evidenceePCR602WS150 Sequence/Annotation Release
Chunk_score Abs_score535
Max_abs_score535R144.12
Specificity_index0.524
Rel_score1
Map_statusTop85_percentile_ePCRIII50038045005985
R144.6 Source_evidenceePCR612WS150 Sequence/Annotation Release
Chunk_score Abs_score486
Specificity_index0.476
Rel_score0.908
Map_statusBest_ePCRIII50038045005985
Overlaps_transcript R144.12 Source_evidenceePCR602WS150 Sequence/Annotation Release
R144.6 Source_evidenceePCR612WS150 Sequence/Annotation Release
WB_DNA_textTH:331B22182gaagactccggcaactagagaagtgataattgcgagaagcctcttttgattgcgatgagctcttgttggcactgctccgccacgtggcaccactatatcactatcatctggagctacgtcatcagtcaaatcatcatccggtgccaccatcagaggacttctttctgacgcggtctgaggctcgtttggacggatttgggaaaaaagaaatccactgaaatttggtgttgtatgtcagaacttcatataaattcttacccaaaaaccacaagaaccaatccaaaatagttaagaaatgggtactcgggtactgtagaatttatcccaaaaagtccaaatctgaaaacagagcatttctcgaaacaatcgattttatgtttgaaaccttccagcagcccatccagctacacaattcgtagttccccagaccaacattcccattccaattccaattgtattcataataggaactgccgtcgcatttcctgaataatcacattcgaagtcaccaggtacactaaaaaactcttaccgagagcccagaacatgccaccaagcattgcaagtggctcgaattctggaaatccttgtgttgaataaactacgattccaaccagaagaatagctgtggacatgatccattgcacgaaaattcctgcaatttttatttagatgagtttatctttgagatatctggagttgaaagagtttttcggagtatgggttactgtacttattggaggcgcacaccttaccgtatttttgcgataaaaaatagtacctaccatttcccgaatgacatttcttcacaggaacaaacatggatccaaaaagaactgatgaaagtgcacatgcacttaatccaacagctatgctcatcctgaaaaactagattctagtaacttgaaaatttttgtcaaactaaaatatttataatggtcaaaaataccaggggtgtagtaatataacatgaataaaagtaattcaatatatttataattaccgaaagagaataaataacaagaaaaaagaagaaaaaaccagtctaaaaacaaaaattgcaagcctaaaacagaagaaaaaactaaaaattctgaaaaaaatcaatcgtccattccaattacagccttcaactcgtcatcttcttcgttgacatcctgaaattttggtatatttttttttcaaattgatcagtatttcgttgaatacttactagaaaattcaattcaaatttcagtaattaaaaagaccaatctacctttaaatgatcatatcttgtaataataggagtcgcaattccacgaatatctccagttgcagtaatctgattccacaacgatggtttgatatctctcataattcgattccgtttcaacattttccaataatattcttttccaccttcagcatgctcaaatgaagctcgtgcggcttctgcatccgcatgaatatcggttagatatctgaaaaataaaaagttgattgaattgaactacaatgtgtttttctttgttttacactggtgaactaggtcagagcagttaggggaaactggttttcgtataattaaagtggaaagaaaacaattttaaaaattcgttgctttgaactattttctataattttttttttatttagcagaagtgcaacaattccgagtgtcacttcagagaaaaagtgtcatttttaattatttttattcgaaaaataacgttttctctaaaaacacgaaaatctccagcactgctcacaattataactgggcatttttgatttttcctcgagtttgtttagtaattttcaattcaattccaaattatgaaattgaatctgattaacctccctcacctatacaataaatgccattgtttattggcataccaagcagctcccagtagtattggataggcaatggcaaaagacgctgctgagccacccattattcttgaactctgtaactcaattagaatgaaattaaaaagggaattaatgtacgtacattatgaatccaatatgtgaagatagaactgaaagttgtccacgtagcccacgagatgctccgttgagcaagtgaagcgtacccatcataggcgtagagatctcggagaaacaggaaatggtgagcctgaaaaatgattttttttaatttcgaaatatgtacaagcttcaaattctcacatta