Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:331G4   

TH:331G4RNAiTH:331G4
PCR_productTH:331G4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK688.1 Source_evidenceePCR549WS150 Sequence/Annotation Release
Overlaps_Gene ZK688.1 Source_evidenceePCR549WS150 Sequence/Annotation Release
Chunk_score Abs_score465
Max_abs_score465ZK688.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII79088687910652
Overlaps_transcriptZK688.1 Source_evidenceePCR549WS150 Sequence/Annotation Release
WB_DNA_textTH:331G41785gctaattggctttagcctgaaattaggcaactattcggcagccaggtttctaaagttttggcacctttgaacatattttttgctgcacttatattttggtgtgcttttgatgtttgtatctctcaggctttttgaatgcgtttctcagaacaaaatttttgaaatttctatcagctatttccaaagttggcaaaaaaatttacttgacgtttgccacacagcttgttacacttatggacagtcttatggaaagtacatgtaattgttttggaaatttccaacctattgttgaatattttccattgaatatttgctcttcaaactttttgtccctcaacaaaagagtcacttaattcaggagatctggtttggcgctccattatccacaccttcatcctcaatggtttcacttacacgtgacgtggcaaagaaacggagaaaactgttggatgatgacgtcattgaactggatttcatcggaaacgacaattaattctagtagtgcaagtgcaccgttgaatatgcaaattattattcttataattaacggaaacttcgcgaaatttccccaccgttttcaagtacttttcacatatttttcattgaattcacttttttcaaatttgaatgtggacacttttttccggtcatttttctaatttgcattacctcaaatagttctgaataatttattcaaaaaatgttactttgtattctgtgtatactgtactttttcacaactgttactcaacaatgtgcaccacattcaccgagtccttggacaaaaacaactcacgtaaataatcatcatcatcatcaaactgttgagaacttttatctaggtaagattttttatacaatttgtggatttctttttgtgttctacaatttttttataattattttttaaaaatgcatatttgagctatgtagaacattcaacaattatctaaatttttttcaattggcaaattgcgaaaactttgaacttttcaataaatatacactttttggagatccttaactcggcatttggcgccaacttttttcacaaatttgacccgaaaagaattccatggatgaaacgttggcggaacttagaaaaaaatatggttaagtttcatctcactcttgccgcatattgaaaaattagactaaacttgggctccccctgagcaaaattcaaaaaaaacgcgggtgaaaaaaactggtgccaaatgccgtgaaatttttccaatctcatatttccagacaaccgaacaatttaccacaagattattgaaatcgagaagcgaattgaaaggattgaagaaaaagagaataatgttctaccagagccatcaaaacctaacaatcctgttgtgaatccacctgtgagccctattcaaccgaaaactgacccagaacaatccgaaaatggtgagtagcatattcaaaaagttcaaaatagtgttaccaacaagtttcagattgcttgtcatgtccttcgctaattccaattttggatagttgtgaaaactgtgttagtgtcaagatatcacctccatttgaatattattcatgcaaagcagttgaacttaaatgtggagatggtgcaaagaaattgaagatttcggatggattccagaaaaatattcacgagaataatttcaagttgatttgtaaaaatggtaagtaattgaagcataaattacatgcgaaattatgcgacatgtaatttttttaattttttaatttttattttcaggaagttggatgatgatggcaaatcacgcggagcataaa