Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:332B1   

TH:332B1RNAiTH:332B1
PCR_productTH:332B1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39E4B.5 Source_evidenceePCR371WS150 Sequence/Annotation Release
Overlaps_Gene Y39E4B.5 Source_evidenceePCR371WS150 Sequence/Annotation Release
Chunk_score Abs_score308
Max_abs_score308Y39E4B.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1316942313170534
Overlaps_transcriptY39E4B.5 Source_evidenceePCR371WS150 Sequence/Annotation Release
WB_DNA_textTH:332B11112acaattctcagatgcggtggcaaacgattcgactaatttccatttatgctgcactctctgcaattaccaattttccatctggatttacgaactcttctgttaacacagctgtcgagaagcttcacaagtaggttttacgcgttaaatttatctaattgatgagtatttttcagattcatcgcgacttctcttcgtcagcccggcgtgccggacgatgaaaatacgattgctctgttccaggtggatttttggatttttcagacaaaattgggcaaaaaatgactgacaatagtcaaaaattggccaaaaaattactaaaaatagtcaaaaataggccaaaaaaagactacgaattacagaaattggcacgaaatcattaaaaacggcaaaaaatgaccaacttttgtcggttttggccattttataggcgtttttttgcgattttgacggagaatagtcgaaaattggtcaaaaaataactgaaaatagtcaaaaattggccaaaaaatgactgaaaatagtcaaaaattggccagaaattactgaaaatttcaccaaaaattgaccaaaaatgactgaaaatttcacaaaaattggcaaaaaaatgactgaaaatcgtcaaaaattggccaaaaatgactgaaaatagtcaaaaattggctaaaaatgactaaaaatagtcaaaaattggccaagaaatgactgaaaatttcacaaaaattggtcaaaaaatgactgaaaatagttaaaaattggtcaaaaaatgactgaaagtagttaaaaattggtcaaaaaacgactgaaagtagtcaaaaattggccaagaaatcactgaaaatagtcaaattttagtcaaaaataaccgaaattggccaaaatatccattttttcagaaaattaataaaataaatcaatttattacagtctgcaactctaaattgctggtttgtcgctcaaatcttcggagcaataatgacaccaatgatttccgatggatatggaagaaagttcggctacatcgtctgcgtcaccacaacaatcttcgcgacgttcgttcaatatttctcaatatgcttctacatgccgtggggattaattctcggacgatccct