Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:332E6   

TH:332E6RNAiTH:332E6
PCR_productTH:332E6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D3A.17a Source_evidenceePCR14WS150 Sequence/Annotation Release
Overlaps_GeneY47D3A.17 Source_evidenceePCR14WS150 Sequence/Annotation Release
Overlaps_transcript Y47D3A.17b.2 Source_evidenceePCR14WS150 Sequence/Annotation Release
Y47D3A.17a Source_evidenceePCR14WS150 Sequence/Annotation Release
Y47D3A.17b.1 Source_evidenceePCR14WS150 Sequence/Annotation Release
WB_DNA_textTH:332E61213catccgttgaaaaatggacgatctaattagacaaaaaagaagacgattgtaaaattaagtgaaagttaatgggccgtaaatagttaaagaaaataaattttctacagcgaaaaaaaaatcaaattcaaaagagattacaaaaagtagaattcttcttgatcatatggaatacgaaaaaccagttttactgtgagtgtgtgtgtggacattgccagcactagccaagtaaaagttctttgtatttaaagaagatattacattggttagtaggagaagaggaatagagaaataagaactggcctgtcaaattgtgtaattttaaaaaaatatggaaaagttttaactttctacatgaaatagtgatatacataggaaatatagtaagtaatgaccatactgttactaaaattgccaaaaaaaaaactagaattagaaatttgtattcaatgtcgaacacgtggtgtcaaagtgtctcatttcggtttgatctacgttgatctacaaaatatgcgggagaagagacgcagagttctcaactaatttcgcatggttaagaacgtgctgacgtcaaaaattttttttgggaaaaaaattccagcatttttgtagatcaaagcaccacgtggtcaaatagttttgaaattgcaaaaaaaattacaaaaattgccaaagttaaaaaaaaactgccaaaaagttactgacattgtcaaagagttcaaaaattgccaaaaattattttttaaaaattcaaaaaaatttaaaaatagctgaaaagttactaaaaatctaattttttcacaatgactttcccattcgaaatgcaattttttttgaaattttaccaattttaaatttacggaattgtcgaaattttttgaaattttagaaatttttttttgaaaatctatattatgagttgatttataaaattccacctaaaatcacaaatttgataataatttaaaaaaaactttaaaaacaatattgccaactacgttgccaacattttttttgtttgaacgcagtgagaaaatgagaaaacgagagagagagattgatataacggaggctcgtagagtggtcagaaatagagaaaactgcagaaaacaacaagaagaacggcggagaacaaaatgaagaaagcaaaatcgttgtttttctcccatatgggaaagagatggcagaatgcgataacttacgccagatcctcttc