Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:333H8   

TH:333H8RNAiTH:333H8
PCR_productTH:333H8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS B0361.2a Source_evidenceePCR156WS150 Sequence/Annotation Release
B0361.2b Source_evidenceePCR156WS150 Sequence/Annotation Release
F56C9.5 Source_evidenceePCR101WS150 Sequence/Annotation Release
Overlaps_Gene B0361.2 Source_evidenceePCR254WS150 Sequence/Annotation Release
Chunk_score Abs_score233
Max_abs_score233B0361.2
Specificity_index0.744
Rel_score1
Map_statusBest_ePCRIII73078617308376
F56C9.5 Source_evidenceePCR101WS150 Sequence/Annotation Release
Chunk_score Abs_score80
Specificity_index0.256
Rel_score0.343
Map_statusBottom50_percentile_ePCRIII73078617308376
Overlaps_transcript B0361.2b Source_evidenceePCR254WS150 Sequence/Annotation Release
F56C9.5 Source_evidenceePCR101WS150 Sequence/Annotation Release
B0361.2a Source_evidenceePCR249WS150 Sequence/Annotation Release
WB_DNA_textTH:333H8516aacttgacctgggcagctaaattttttggagagatcataactaacactcttctgtaggaattttagcatgagaaccccaaatctacggacccccctcaaagacttcccttgtaaattcaattacctagtttttagaaaaataaaaatagaaaagcaatttaatttttttcaggaaataattgccggaatgcttgatctaccaccgaaaaagtggagaaaacgagaaaccgatgaaatgtcgaagcagaagtctcgtgctgaaaatttcaaaaagctctgggagccagttgattggacaaaacggttgaaaaatgattcgacaaagtgattatcttgatttattccataatttgttattctctgtattactcttttattgtttttatacttttcgcttcattatgaaatatcaatttcaaaacgatatagaaactccattgatctcaacagtctctccttcaaatcctttaactgttgtacggcccaatgtggcgaagtgctcacggagttgattct