Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:334A5   

TH:334A5RNAiTH:334A5
PCR_productTH:334A5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSW05B2.7 Source_evidenceePCR711WS150 Sequence/Annotation Release
Overlaps_Gene W05B2.7 Source_evidenceePCR711WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627W05B2.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1098796610989613
Overlaps_transcriptW05B2.7 Source_evidenceePCR711WS150 Sequence/Annotation Release
WB_DNA_textTH:334A51648atgaagcccttcacacctgcgaacaaattgaaaaactcgcagaaatggggaaagaggtggatattgaggctgtgcagcggagaattgtggagaaggagaccatgttgtccaagatgaatcgggagagaaataccaaaggcgctcgaatggaggtgctctccgagctggttgctgtaaaggctaccaatctggaaaccatgagggccgaggaagcagcgttgaaaactacggtagaagcaatggtttcggtaggctttgagttgagggatttgaaaaatcaaacatgtttttttcaggcaccacaagaagaattccggaagtgtgtagaagagctgctcaagttctcaaatacagacatcaaaactctatcgaagatcacaaagccttcagtgggaatacgtttgtgctgtgagatgcttcgcactattttcgagccgaacttcaagccaagtagatttttcagcgctttcagaattgcttcaggtactcaaaataattgttacagaacggcacgcggcagaagcctggacggaatccttaaaatttgtgagcgacaaggcgtttttcatcaagctggccacttgtgacgcggatattttgacggtggaccagatgaaggtactgaagaaatacgtggatcgagccgagttcaacgcaaacaagatcgaacacgagtcggtggtgtgcgcgtgtctttgccgatggatcggagcgtttttggagttggcttggtgagtttttggaggatcttcatagagatcttgagagaaggtccagagattttcgggctttaaacatttcagacaggctaataaatcccatgatcctcaagacctcggagatcctagaaagacaaggtgtcggttcagagtctctggaacttcttcaaaggtcccggggcatgggttgttctataagatagtttgttcgaaagatccgaggggcctgcgttttcagggccccctcaggatttacggctttcttcttatctaggctcgcctgcagattccatccaggctttttagggaatctggataaagctgtgacacctccaggctgttcagaagctccgctttgttttagtcgccctggggtccctggaggttcatctcatcttggtggtcctgggtcttctgggatgtattcggattaagcgtcggatcctgtttgttccgaagctccggcttatcctggttttctggtgctccaatttttaagcccattcattttaagcctaacacccaatcccaattttccagcacacttcgagtaatggaagaacaagtcgaggagagcaaggagctccgcgagcacattcgacaaaccgaggtgcggttcgaaaacgagtccagcgaaatgcaacagttgaaaagcgatgtggaaaaggtttgcgctcaaaatctctcatattccgggtgtttcgcaatccccgtccattcccctttttctctgcatcccctcctcttttcccagcctccatctctgcctcctcccccaacagcctctcccatagcccccagcggaacccatgacatgtctgctacactccttactgcccctatataaacagcccctacccgctagtatttcgttcttccgagaacatatactaaaattggaacaatacagagaagattagcatggcccc