Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:334F11   

TH:334F11RNAiTH:334F11
PCR_productTH:334F11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y54H5A.1 Source_evidenceePCR1179WS150 Sequence/Annotation Release
Chunk_score Abs_score1074
Max_abs_score1074Y54H5A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII51535345155121
Overlaps_transcript Y54H5A.1.1 Source_evidenceePCR1179WS150 Sequence/Annotation Release
Y54H5A.1.2 Source_evidenceePCR1179WS150 Sequence/Annotation Release
WB_DNA_textTH:334F111588atgaggatccagtggaggatatagacgagtctgaagaggaagttgatgaaactgatgatgaagacgaggaagtaccggagaatcagagacaagtgagctagaaatttcgtacaatacttctaattgttaaaattgcaggcttacattccaggcctcagccggccattgaaaaaaggagaagaattggattttgaccctagtgcttacaaactatttcatagtttcaattctggtgattcaaacgaaattgtttctaaaatatttatattttatgatttagattggccatgcttgtcgtttgacgttgttaaagatggtttgggcgagaacagaacacaattccctgccgaatgttatattgtcagtggaactcaagccgataagccaagggataacgaaatcattgtgatgggattgaagaatcttacaacgatgagggttagtcggtttcaaacttttttattatttacctgttatgaaattgaaattccggccaacgtttagttttaagctcagtaacacaattgttaaactaaaaaaaacaaggatatctctacaataaaagtgagtatttcagaaagaaaaagaaaacaaaggcgacgacagtgacacctctgaagacgaatccgaagatgaagatgccgaagaagagaagaaaagagaaccaaaaatgcacgctgtttcgattcctcactatggtggtattaaccgaattcgttccgatcgtcttggtgacagtactgtatgtgcttgctggagtgatcaaggacgtgtccaggtgtggaatatcactgatgcattgaattatactcatggaatgagcggagagtcgaagactgaagtgcaaaagatcgatcgacccttgttcacgaataatggatctggaaaagaaggatatggacttgcttggtcttcattaaaaactggagacttggctactggtgatatcatcaaaaagatttatttgtggcaaatgaaggaaggaggacaatgggctgttggagctaatccattaactggacataaaagtaatttatttaattttgatctgaaaattccaaaaattgaaatgtgtctcctgaatggcgtttgagtggttttttcttgaatagattggaaaaaaacaaaaatctgaattaaaaacttgtctttgtcgcataaaaatttttgagcatttttcagtacatattccaatatttttcagagagtgtcgaagatcttgcatggtcaccaactgaaactggacttcttgcttcatgttccgcggatggaagtatcaaactatgggatacacgttctgctccaaaagatgcctgcgtctgtacagtgcaaaaagctcatgaatccgatgttaatgttatttcgtggaatcgtcacgaaaacctcattgtttctggtggtgatgacggagagctgaaaatttggtctttgaaaacaatccaattcggtcaaccagtggcactcttcaagtatcacaattcaccaatcacttcagtcgactggcatccacatgaaacaacgacatttatggcttccggtgaagacgatcagacaacaatttgggatattgcaactgaagcagatggac