Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:334d1   

TH:334d1RNAiTH:334d1
PCR_productTH:334d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF43C1.2b Source_evidenceePCR820WS150 Sequence/Annotation Release
Overlaps_Gene F43C1.2 Source_evidenceePCR1073WS150 Sequence/Annotation Release
Chunk_score Abs_score1031
Max_abs_score1031F43C1.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII42171134218778
Overlaps_transcript F43C1.2b Source_evidenceePCR1073WS150 Sequence/Annotation Release
F43C1.2a.1 Source_evidenceePCR1073WS150 Sequence/Annotation Release
F43C1.2a.2 Source_evidenceePCR1073WS150 Sequence/Annotation Release
WB_DNA_textTH:334d11666ggtgcattcacatcacagctggaatggatatacatatatattttttgggggatgaatatattacaaaatacgtaaaatattagaaaattttcaacaagcttttcagcgggaacggggggttactaacaactaaacgatcgagttttgaagtggattatgatacatcgaaaaagaaactgaaatgccaaaatcttagtggaaaataaaaaaaaagtggaaaaaataactaatttagtgggtaaatactactaatctaaacaggattctgccctccattattccttgcagccgcttctgcctccattcgtctgtgatgagcctcggcttcttcccaaatcagctccttcagcttctccttcggtaaatcgtcgaattccatttccaaagtgaatggttcctcacaaactggctcatctcctggatcgtagtattgctccaagtatgggtgagccaatgcttgctcgatgtcgatactgaaaatcgaaatcattatggattgttaaagcgaatatctatgtgaaacacttcaaaaaaatttctctgattatatattttagcttgaaatcgtgaagaatttaattttgtaactgtaaatagactaaaaactattttcaaactcgtgctagagaaattctcattagagcgcgctgcttgtttagatttacgagattttttaaaattgttctactattttccttaatttttgtcgggtgttttacttaaaaatgtgtttttttcgtgtcaattttattaacataaaattaaatttttttttcgaattgaaactcgacgaaaaattcggaaattctaccagtttttgataataaaaatttcacttttttacccggaaaaaactcgtacgtaaatcgacacagcccggtgcgctccaatgagaattttcaataaattctcaatatttcaagattaaattatcttaccgattatgtggattgaaagtgagcattttgtccaataaatcaagagctcttggatcagctcctggatagagccgagcccatggttgttttggtttgtgtggcaatgaaatgagatatgatcgagccttatcattaataatacattgtaaatcagcatttgacggggatccaacaactgccaaaatcaaattgagttgatccaaataatgttttcccgggaacaatggccgattactgagcatttctgcgagaatacatccgacagaccagacatcaatcgatttagtgtatccctttgaattgagcataatctctggagctctataccaacgagtagccacatactcggtcaagaacccagtatgatcggtttgtgggtcggtgacacgtgccaatccaaaatcgcaaattttgagatcacatgtggtgttgagcaacaaattcgatggtttcaaatcacgatggagcacatttgcagagtgaatgtatttgagaccacggagaatttgatagagaaagtagcaaacgtgatcatttgagagcttttgagttttcagcaatttgtacaaatcagtctccatcaggcattgaactatgtaactgaaaaaaaaacattatttgtaaaattcacttgaaaaagtagttttactctttgaaaagaaaataggggaaaaattacaacaattctcgattttttaaaagtatttttcggtcatttttcccctgta