Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:335C8   

TH:335C8RNAiTH:335C8
PCR_productTH:335C8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y32H12A.2 Source_evidenceePCR964WS150 Sequence/Annotation Release
Chunk_score Abs_score859
Max_abs_score859Y32H12A.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII53477935349388
Overlaps_transcript Y32H12A.2.1 Source_evidenceePCR964WS150 Sequence/Annotation Release
Y32H12A.2.2 Source_evidenceePCR935WS150 Sequence/Annotation Release
WB_DNA_textTH:335C81596tttctgtgtcgtttgtgccaagaattcggaattcgaagagcttgtctgaaatatggaaattgtgaaaaatctgatagtttctgatttttgcattcaaatgtttaatcaattttgaccagttttttcaacatttttaatggtaaataatcttttaaaaaactgcttcaaaatttaattcgagtagatttttatcagaaaatggtccataaatttttcaataggggttttctatgttttcctagtttgtcaagtaagttttaagatttttaagttttttttaaatttaacagaaccgaaacatttgctcaaaattcgttaaaattatctgtaaatcgattgaaattccatttatttcgagaaattttcagatttctgagagatatttcctgatattttatatcttgttcgtacagtttttgctctaaatctttgcaaaatgccagattttcgacaatatttcgcttttaaaaatctcagtgaaataatatctaaaaccgcacatttatacaaaaaatttcgcaaaattttcgaatattcaccatcatgaatttccttataagcagcagcatgtatatgtgcaacagcaagtggagccggcaattgcaatgagagctttcgctgctccccttcaatcgataaatctttgaatttggcgccaaccatttcgaagacgggctccgcaacttttgtgagatcttcaagttttggtttaagaccttgaagacgaacttcttttccacgtatgtcgctttgcagtacgtttcgacgaccctcgagctcgttgagtgtagagagaagtctgaaaaaagattttaaagagatttttattgaaaatctcacaaactctcgtctctgctcattctcgaacttcaatcttgccaaatattgttcgtgctcgttatcagccgtctcatttgcaagaatctccgacgcttcagtgtgaaattgctcgaaagggaccaactcaagctcctcatcaccggcgctaaagtccaaacaacgatcgatttctttttgaatgtgttgcacctcgctagtaacattctgtaactgtagaagcttcgcatcaacgttctccatcctctcggccacctcttttcgcattagggcagttccatagtgggtaagtcgtgtatttcggcgtaaacgcgcgattttcgagatagtatccgaggatgttggctgaaaaatcaattattgcttttaaatattcaaacagctgcctccctacctttccatccaagtattcttcaacagcatttctcaaaaatgcgtaatcttggagaaattcttcgaaaattcgatcgctacccatttccgttgcaattttgtcttccagattgaacagtttctgaattaaaaatcgataaaaccgttaacaaacgcttgttgaaaaacctcagggctgtccattttcggcatatcagtcaggagttgtgtggctttttcagataatttaatttccggatttttctttttctgttcttcaacaaatcgcttcaccgggcgaacgtttacagacattttttcgctgaaaagaagaagttaatttgaaaaagtacaataaaaagtacaacaaaaatgctgtccgagagg