Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:335E1   

TH:335E1RNAiTH:335E1
PCR_productTH:335E1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSH04D03.3 Source_evidenceePCR239WS150 Sequence/Annotation Release
Overlaps_Gene H04D03.3 Source_evidenceePCR239WS150 Sequence/Annotation Release
Chunk_score Abs_score176
Specificity_index0.367
Rel_score0.581
Map_statusUnique_ePCRIII1044260610443508
D2045.2 Chunk_score Abs_score303
Max_abs_score303D2045.2
Specificity_index0.633
Rel_score1
Overlaps_transcriptH04D03.3 Source_evidenceePCR239WS150 Sequence/Annotation Release
WB_DNA_textTH:335E1903caacttccgtgctgagacccgatgtgaaaatttaatgtctgcgcctttaaagaatacctttcaaagagggttacggtcaaattcgaattttctctcgtttttccacctatttttcaagcttttttgctttctttttgacaaaatggaatattttttccgatttaaaactgtctcttcctctatgaattcaaagggagtcatttatacttagatggtcatgtctcgcaaccagaattcatctcaaatagtttttgtgagaaatttacgtaaatcacgcctaaattacacgaaataaagtatgaaaactggcggaaaattgcgtcgagcgatcagtgttttgtccacaatgtgataagctgttctcagcgttgattcctggagttcgtgatcgaaatccgtcgattcggaagcagttcgccaatgcgatgtcgtacttggcgaagttcacatcgccgaatcagatgaagaagttgattaagacggtagtggccgatttgctcggcagtgatggtgaatttttgatttgtttgcgaaaatttttgaaaatatgagattttcacgattttaaaatcgaaaatcaaattttggttttaaaaatccaattttttttgtaaattttaaaattttggacttcttttctgaatttttggcagaacatcgcgaaagttttaatttttttttcctcgtaaatatgatgctggatttttcaagcatttccccagattttttcaataatttctatttttcagaggatctcaagacatccagttgccacgtcatcagtaatctcgctgcaaattctcaggaaatgcttaaaggatacacatcacaaatcgtgccatacgttctcctggaaaagtgtcgagaagtgccgaaagaagatgaaatcgctcgagaaaagca