Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:335E5   

TH:335E5RNAiTH:335E5
PCR_productTH:335E5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR01H10.6 Source_evidenceePCR816WS150 Sequence/Annotation Release
Overlaps_Gene R01H10.6 Source_evidenceePCR816WS150 Sequence/Annotation Release
Chunk_score Abs_score734
Max_abs_score734R01H10.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1025888310260466
Overlaps_transcriptR01H10.6 Source_evidenceePCR816WS150 Sequence/Annotation Release
WB_DNA_textTH:335E51584ccccgtcaaagtatgaagcaaacgcgtcgggacggattttatcgtcgatttctacgtcatcttcgttgttgtctatgatgtcgatttcatcgtcgtccttgcggggctctactttctgtaaatgtttggttttatttgaacgttgcaaaattttctaattttgctgaatcataggtcaacttttgctgagtgatcacttttataaggtgtgggagcgaaattttgaaaagggtcgaaaaaattgagcattgtggtttttgaggcaacatccaaagttcagggaaagttccgctcacggcagttcaagtaagtagggtactgtagtttagggtaggatcctacgtattgtagaaactataaattatatagcctataggacgagttccaaaaagcctttatttgaaaaatctgaagatgattcttcattgaatcatgtagtaaggtgcactaaaacaacataatgctaggaaagtcggtgacgtttttcattttaaaaatacctcggcaatctccttgacatacgaaactccaaagattggcttcaacaaatgcgccttatgaagtgattgtacagttttcagaagattttgtagacgttcagcaggatcaactctgaatcccaacacgtactctccgctgctggtagttgtctcaagaaccagcgccattccaaacttggactctctaactctgactgaatatagagtaatgtaggggaccgaaacattgtatccgatgttcatctctgcgtaccaaacgacacgaatattcgtgatcacaaagactccgagacttccagtctccgtcgacagattccagacaccgttcaccttctcgatgatcgtctcttgtggaaggatcttcagagttccgtcctcacgaataaacaccccgcgcattttgagctctctgtacattttggtggtctcgtaggctctgctgattgatgagatcgtattgaaaagtttcgaatgagatgcaggatttgtggtggtgaagatgaactcaaattttgtagtggtcgccgagactttggcaagtacgtagattgcttcattggatataccacggtttcttgtgactagctgaaacttttttcttggaagttaaaaaaagattatgagttttgataggtggccgcgaaaagtaaaactaggccatcgatttttcgttgcgaattcgacagtagaacccaccgaagtagtctgtttgctctgtactccggtgatcgcattccacccaatcgtgatattgatccgaggcattgaggcggcatgccagattaggcgtaagttggtgactcgcatcgttcctgaaagtgtgtcaatttttcaaaaaaaaaatcgcgcttctttcaatttttctctagtctagagtttgtaaagtatgggcgaccctaaaaagaaacgatgcaaatctgcaaatcggcaattgccgaaaaattgccggaattgagggacgaatttccgttctaattgtgacagcgatattcaattttatttcgttttttctattgttttgttattttttgtattttcttttaatatcgtatcgattgatcaatgacttcggtaaatcgacacc