Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:335H7   

TH:335H7RNAiTH:335H7
PCR_productTH:335H7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK632.5 Source_evidenceePCR1048WS150 Sequence/Annotation Release
Overlaps_Gene ZK632.5 Source_evidenceePCR1048WS150 Sequence/Annotation Release
Chunk_score Abs_score964
Max_abs_score964ZK632.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII98092749810934
Overlaps_transcriptZK632.5 Source_evidenceePCR1048WS150 Sequence/Annotation Release
WB_DNA_textTH:335H71661tcgagaaggccaatcaatcgaattttttcatcttgacaatcagggattctacagaaatctacttgatatgcatcgaggaatcagttcagatttatttcaaatcgatggagattatcatttttatcaatccaggccgtgtcgagttcaagaatggaatctgacaacaactcgaattattcttcaaaagcatatattcatagcgaatcaactggcagaagccatacaaaagttaaaaaatatttttgtaactggaactgacaattcgattcggcttatgatgcagaaatatttaattgatgaacagcagattttcttcgaatattttgaatatatatttgacgagtcagcaagtacatcctacaattttcaatcgatcgttgagtgagtactgacaaaaaattaaattaaatttatattatcattatataaattattgattaaattcaaaatttccagaaatctgcccaaattgaacatccacgatgcctcatgtcgatttcagatttgtgatgacatatttgaaatcgttagcgcacattatcacgttatcagggaaatgatacaagttgttgggaatattaatgattacagtgtgagttttgtaaaaagttttgtaaatgtgggatttgcttcaaacaccaataattctgtttgattttatacaaaaaatgaagaaaataccaatttacattgttttttccggataaaaatgctaaaaatgccacttttactgtaaaacgagtaaaaattgcaactcccaggtgattttattggaaaaataggtaaactggaaatttctatcatttttttccccgagaaattccttcgtatttttatttgattttactgttaaaaaactaaaaattgaaattttcatgtattttcgattaaagtttgacaaaaaaagtgtttatatatttacaattacagtgaaaaggcgatccccctggagtaaaaaaacttttatgaaagctgaaaagttgatagaaatccaccagaaaatcactacaactgctcataatttctataattttcttcaaagaggataaaatattttttataatttttcagcctatccgtctcaatgaaatgtcgttcactggatctcaatcagctcctcaattttatgcgaaacgaatgtggagaaggctgaatgttgaattaattcgattcattgtgaagtagggttttttcaatttcaattttcatttaaaattaatatattgatgacatttttcagtaaactggctgaaatgctcaccactcccgatgctgaacttatggagctcctcactgacgccggagatgccaagcttatcaaagatccttcaatttggcaacgcctgaatcctttacaaatggaatcttcattgtgtattgatgaagatcttgcaaatcgagttgcagatcttataattggttatcaattttttgttaatgataagaagagcaaaagtcagaagttggatgaaaaaacattcgcaaagtcagatattcaagacgctgaagagttggaattgtttgcaaaaactcctgaattcgagataattattcagaaaatattagatagagtggatgttaactcagtaacagaagagtctgaagagttgacaatttgcatcaataaacttctcgaacaaattccaactacgacgcttgtt