Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:335f2   

TH:335f2RNAiTH:335f2
PCR_productTH:335f2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F58A4.14 Source_evidenceePCR417WS150 Sequence/Annotation Release
F58A4.4 Source_evidenceePCR216WS150 Sequence/Annotation Release
Overlaps_Gene F58A4.14 Source_evidenceePCR417WS150 Sequence/Annotation Release
Chunk_score Abs_score354
Max_abs_score354F58A4.14
Specificity_index0.656
Rel_score1
Map_statusBest_ePCRIII96108539612505
F58A4.4 Source_evidenceePCR249WS150 Sequence/Annotation Release
Chunk_score Abs_score186
Specificity_index0.344
Rel_score0.525
Map_statusTop50_percentile_ePCRIII96108539612505
Overlaps_transcript F58A4.14 Source_evidenceePCR417WS150 Sequence/Annotation Release
F58A4.4 Source_evidenceePCR249WS150 Sequence/Annotation Release
WB_DNA_textTH:335f21653atggcgaccaagtaggaaattacatcttccagtttcataaaaatatctgtaataaatagataattatttgaaattttcctatatttaaaggtattcctttactggtacaagaaagaagttggcaccaacgagttttggcaagttttggcaactctcttgttgcatctgacattgaaattgacattttatatattatttgtgaagttttttcaattaaattatattaatttactgtaaaaaatgactgaaaattagaatttgtatagtttgttcgcaaaaacttgaaactatgcactaaattttttactaaaaatcctggaaatttcataaacgtatttttcattatcaaaataataattatgtggaatatagaacttgtagctagtactgtgactgaaattgtggcgagacccactcaaaaaacagcgtgtgcctttaatcgaattcttacgaaattacaatagtttttcaacattattgttaacaataaatcacagtaaatcggtgacatgaaaccctgaaaagaatttcatcgatttttaatagtttttagttttccaacaaataaatttgttttcaacggaaaactataaaaatcgatgcgaattataatcgatatatcgaacgcggcaacgaaagttcgaagctacagtactctttaaaggcgcacacttttttggaaacaataaacaaaaacttgtcgtgtcgagaccgggtaccgtatttttggcgcaaaaatcgttaaatgaagcgcacctttaaggcaaagtttccttttttcactaatttaccatatacggccatattcaccttttatttttgccagaaagctcataagctttatgaaagcattccatcgcttcttcaagttctccttcatttcttgcaattagtccacgaacatgaaaagcagcttcatttctttcaagatatttgctttgaatttctccaattattgatttgcactcaatatagtcgccttgggcaaaataatgatacattagaccatttaatgagttacaatcgagaatttccactcgttttggagcagacggagcacgttctggtggaggtggtggaacatcaagggatgttggttcaggtactacttcctgatgaacagaattataaacgaaaaaatgtttcaaattatttcattaactcacttctggattgtcctgttcatttggaataacgtcagttccaataatttcatcttgattactcgcttccatttttaataagctatgcaccctcaataactgcctacgtctttctccttgccgttgccatggaaactcgcggacgccacatgctataaaaggtctcgagaaaaaaatttattgttaaagtagaaatcatgttacagtataagaaaaatgaaagtaatttatgaaatgcaagccgatacaaacttttcaaagttttcaacgtaaggtgcgagagctccatgcttgtacgccaggaattttcgattcttcgaatcctcgttctcgtcgtttcctcgttcagccaaaagactgctcaactcttccacgacatgactgaaagtttttggataatactattagagagacgactttttacttactcaattcgaggacatttgcttacatcgaactcttcaattttaccgacattcagaggaactgc