Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:336A5_13   

TH:336A5_13RNAiTH:336A5_13
PCR_productTH:336A5_13
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K08A2.5 Source_evidenceePCR783WS150 Sequence/Annotation Release
Chunk_score Abs_score697
Specificity_index0.037
Rel_score0.076
Map_statusTop50_percentile_ePCRII29806642982125
ZC239.1 Chunk_score Abs_score904
Max_abs_score904ZC239.1
Specificity_index0.487
Rel_score1
T04A11.11 Chunk_score Abs_score882
Specificity_index0.475
Rel_score0.976
Overlaps_transcript K08A2.5c.2 Source_evidenceePCR90WS150 Sequence/Annotation Release
K08A2.5b.2 Source_evidenceePCR762WS150 Sequence/Annotation Release
K08A2.5c.1 Source_evidenceePCR175WS150 Sequence/Annotation Release
K08A2.5b.1 Source_evidenceePCR783WS150 Sequence/Annotation Release
Overlaps_pseudogene ZC239.1 Source_evidenceePCR990WS150 Sequence/Annotation Release
Map_statusBest_ePCRII32269193228380
T04A11.11 Source_evidenceePCR990WS150 Sequence/Annotation Release
Map_statusBest_ePCRIV1251018512511646
WB_DNA_textTH:336A5_131462tcaagcttcctggtgctctcggtaatgccaaaacttgataaactctctttaacaagttcctactaaaattcctagcacgcactttagatgtttcgactgtgtagtcaagctgatttggcaaaatatgcagcaggaaacaatggaaggcttatcaggaatcaaatcgtttttctttgattacaaggttccatgggaccaatatttcaagttaaattgtccctcacagatgttatttactattttttgcgtgaattattaaatgtggaattgtggcatgtgttgtggcacacatatagaggctggaaagcttacttcgaaagcagtctaacttgcaatgcctcgaggatctgccctttcggacactgaacgcgctcagctggatgttatgaaattgctcaatgtgtccctgcatgaaatgagtaggaaaatttcccgttctcgacactgtattcgcgagtatctgaaggatccggtgagctacggtacatctaaaagagctcctcgtcgcaaagctctctccgtgcgtgacgaacgaaatgtgattcgtgctgcctccaactcctgtaagacggcaagagatattcgcaatgagcttcaattgtctgcttcaaaaaggaccatcctcaatgtcatcaaacgatctggtgtaatcgttcgtcagaaacttcgccctgctccgttactctctgcagaccataaactcaagcgattggaatttgctaagaacaatatgggaacgaattggagtaaagtgagaatttaaaaaagcaagagtgaataattaggatcattgttttaggttgtcttctccgatgaaaagaaattcaatctcgatgggcctgacggttgccgctactattggcgcgatttgcgcaaggaaccaatggttttttcgagacgtaattttggaggaggaacggtgatggtttggggagcgttcacggagaagaagaagcttgagatacagttcgtcagtagcaagatgaacagcactgactatcagaacgtcttggaactggagctctccaaatatcttcgtcactactccagaaaagactttagatttcagcaggataatgcgacaatccatgtgagcaactcaacccgcgactatttcaagctcaagaagatcaacctttttgattggccagctcgaagtcctgatctcaatccaatcgaaaatttgtgggggattcttgtccgtatcgtgtatgctcagaacaagacttacccaacagttgcatcgttgaagcaaggaattctcgacgcttggaagtctattccggacaaccagctgaaaagtttggtcagatcaatggaggacagactgtttgagatcatccgcacacaaggaaacccgattaactattgatcctttcttgattttagtatatgaatgttctgttgttgatcaaaaataactgcaacttgttaatacgctgtttctgactggtttcttggg