Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:336E3   

TH:336E3RNAiTH:336E3
PCR_productTH:336E3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0361.2a Source_evidenceePCR154WS150 Sequence/Annotation Release
Overlaps_Gene B0361.2 Source_evidenceePCR154WS150 Sequence/Annotation Release
Chunk_score Abs_score112
Max_abs_score112B0361.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII73006687302778
Overlaps_transcriptB0361.2a Source_evidenceePCR154WS150 Sequence/Annotation Release
WB_DNA_textTH:336E32111gacaggacattgaagcaaaagcaacagtagcctcattgctagcagacacagaaaagaacactgaaaagtagtttgcactcgttatttttctcgattactatgaagaccctccttcgaatagtacttccactactaccaggactactaccacttttcagtcaacaaaaggatcagagtacttgtggaaaatgagagttctccgaggtcgagatgaggcatcacgtggaatcatcattgaatgcttagttggatcactctgtttagggtgtttttctcggagaattccctccaattccacttgatctctagaagtggtgtggactatagatgaccgttggtctgatcggattccataggattttcaatgacactttattagctattatcaacacattgacatcattcgaaaatgtaatttgaaaagagaaaagaatcacgcatatgttagaaattggacacaaacattcatttactagaaagaatttggagagtgtaaagctgagtatttctcatattttgagtttttcgaaataatttcacattgccaccttcagtatctgtagttttataaatatttttatttttttagtatgcggttataattttaatttttcgaaacgacattctaccgaataagctctaattttccaatttcaatatttcagaacacaagcgaatcgaacgttcatttgacgactgctccagatgtattgatagttcaagattaaagaaacataatatcattgctgttgggattaacgtaagttttccattatgtagtttaaatatcttaaattgaaaaaaaaagtctacagtaatctaggaaagatagggaattaatttatgttttccttttttgtcatactaactatgatatattttcgatacagtacactatttcaactagtttcacgtttttgcaacatcttagcagttcgtgttcatttccattgttttctagattcttgaatagtcttcattcatcgaattattaccacttcagtttcatttaaagtgaccacacctgctttttgccaacctccttcgcgccgccaaaattcgaaatttacgccaataaaaggaagtaaaaaaagagtttgacaagatttgtggcattgatttccccccacgacgaagaagagggcactactgtcagaaattctcgagatactgatctttttaatttcgcccattgagatttcgatcggtttgaaacggccgtctttacgggggtctcgtgtacttatttttgaactaatttaagaaactgatcaaaaatctatagaaagaatgtagaaataaatattaaagagggaagttaactatttagagcacttttttgaaatgcgattctataaacagaagcatctgaaattaatactagtgaagagttgcatgtaaaaatcagatatcgacaattatgattatattagaggcgagcgaaaggaatataaaataaagttgaaactatttagcggaatatttggtaatttcaccaaaatcaaaacgaggtttctgttcactcaatcctgtgaaatctagatcaaactcagaatctcatagaaaaacgattgactatttaaaattcttgttccgatatttcactttttcacctggaaaagtgatatatcagtccacagatacgtcaaataccgttgccaatgaaaaatgaaaaattgccaactttccagtaattcagaaatgatcaaaaatcggtgaaaagacgacgtgacaattcgagccccttgattcattcttcttcactcacttcactcacttacaatacacatacacgcatacaaaaacactagttatttgtgatgtttggtttcttaatgaaaagtagttattgaacgatcattccggcaagaagaccgcccattgtgaatgaatagtaaaaaaatgggtttctatggaattaatttgcatattttaaatctttttatgcaaaccttattctgttagactcggtaaattgatttgaaatagacaatatcattcggataaaatatatgaaagttggctgaaaatgtgaattttttttattttcagacatatttggcagttgtcgaatgggatggactggacgatgagcatttgatcattgtgcc