Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:337C8   

TH:337C8RNAiTH:337C8
PCR_productTH:337C8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D3A.13 Source_evidenceePCR411WS150 Sequence/Annotation Release
Overlaps_Gene Y47D3A.13 Source_evidenceePCR411WS150 Sequence/Annotation Release
Chunk_score Abs_score369
Max_abs_score369Y47D3A.13
Specificity_index0.614
Rel_score1
Map_statusUnique_ePCRIII1122295811223983
W09D6.4 Chunk_score Abs_score232
Specificity_index0.386
Rel_score0.629
Overlaps_transcriptY47D3A.13 Source_evidenceePCR411WS150 Sequence/Annotation Release
WB_DNA_textTH:337C81026caattttcagctgacacgaaccaaatctgtttaagaattttttaaagccgaagttgtagaaattgtagggcgtcaatgcaggcgccaaaatgcctgccggcgacctgcctagcgcggcgagtagaagcaagacgagaggcaggcgtgaggcactgtgaaaaaactatttcattcgaataaattgaattatcgatttttgagggaagtagggaaaactatcgagattctcaggcgcactgtgaaatttatgacgacaaattacaaaacaaatagtgaaaatccgtactctacaaaaaatcaataatctacaaagaaattatatattttgcaatatcattaatccaatatactaaacaaagtcctttcaacctcttcattctttaataaaaaaatacaaaaaccttcatatcaacacacaagcatacagattaactccgaacaagtgacgtcattgaccatgactactccacgtggagttcaacatcatacttgtcgagaaattccagcgcctgcttatgcagattctttgttccttccacatcgattttcatgccagatgatcgttttccttttcctcctcctccatttccagtatgatttgcatttggtagttggacaactgcggcgtcacggtcagcgtcagtcattgttgcaaagtgtgccgccgcttccgcaacatgtttctgaaatttttaattatcgatctttcagaacgaaattatcgatttttctcgattttctgcaacggaaaaaactaaccttaagagcggcagaaatgttcttatcctgaagtgtatacttgttgacaacgacatccggtgcagaaatctcggccttgatgatatgtggatcattattgtaatcattgatctgttcagctatcttctgattgtgtcgttcacttggcactagttgacaattgacaattgacaattgaagcaccaacatgatgccaatacatccagccaaatatccaaccatcatattcttctttttgttgtgtttcttcgcacagaaggaatgact