Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:337D10   

TH:337D10RNAiTH:337D10
PCR_productTH:337D10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY56A3A.11 Source_evidenceePCR184WS150 Sequence/Annotation Release
Overlaps_Gene (3)
Overlaps_transcriptY56A3A.11 Source_evidenceePCR184WS150 Sequence/Annotation Release
WB_DNA_textTH:337D101443gggccaaacttgaaaaatctcaactttttcgggcaattttttaatttttaaacaaattttcttaccggaaaagtcaaaaacgggaattatctcaaacaaaaaattcgaaaaaataacgaaaatgtttaatttagactaaactccctccaaatgagatctccccggccaatcagcgcctgcgaactccgcccactccatctgattggttgaaaagtgggcggagcgagtcgctgattggtcgggaagttctcattttggagggaatttagccaaaattttgatttttcgtgtttcttctgggattttttttgcgaaaaaaatgaaatcctaacccgcccactcattggcagcttgctcattgagctttccatttggctccccgcaactttgactgaagcatgatctactgacacctcgactctctttcctctcatccttcaaccactggccaattccagacatttcatggataattcgtgaagctgtctcatcaaatatctcgacaagtccaccattctggaaaaaatatcgattttttattgatttttttcaaaattattatagaggcgcagaaaaattcccgatttgaaatcgaaacgcgctctatcggcaatttccgcctccgatgcatgggtcccgctggggttttcacggagttctggcctttctcattgaatttttcgcggcgctccattggcaatcgcctgccggacaacgcgtgggaaagtcgtgtacttcacacggacaagtgcatttagttttacaatcgagccgcgacgcgacacgcaacgcgccgtaaatctaccccagatatggccgagccgaaatggtcgagttcggcaaactcttccatttaaatttatgagggaagccaaaaatcagtgattttggcggcaattcgccgtttttatagatttttatgctaaaataatgtaaaaaatcattaaaaactgtttgaattcacgattttgccgccaaaaacacaacgggacccaatttttccgcatcttcataatacgaaacccaccaaaaatgcatcaatcaggacaatcaggaggattgatgcatttttggtgggtttcgtattatggagacgcagaaaaattgggtcccgttgggtttttggcggcaaaatcgtgaattcaaatggtttttaacattattttagcataaaaatcaataagaacggcgaattgccgccaaaaacacggatttctggctttcctcataaattgaaatggaagagttttttgccgaactaggccattttggctcggccatatctggggtagatttacggcgcgttgcgtgtcgcgtcgcggctcgattgtaaaactaaatgtatttgtccgtgtggagtacacgcgctttcccacgcgttgtccgacagacgattgtcaatggagcgcgaaaaattccaggttttttcccatttttctgcgt