Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:337E11   

TH:337E11RNAiTH:337E11
PCR_productTH:337E11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY111B2A.21 Source_evidenceePCR723WS150 Sequence/Annotation Release
Overlaps_Gene Y111B2A.21 Source_evidenceePCR723WS150 Sequence/Annotation Release
Chunk_score Abs_score639
Max_abs_score639Y111B2A.21
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1274550812747595
Overlaps_transcriptY111B2A.21 Source_evidenceePCR723WS150 Sequence/Annotation Release
WB_DNA_textTH:337E112088gaaaatgaaatccggcaaaaattgtaatataattataaatctatacttttgtggttttttccaatatttctataaattcttgatttttaaaataatcaaaagttttgattttaaattttggaaaaattgaatttttgtatatttttctaatcgtaaaaaaatttttaaaaaaatcgaaagcggatttttttctgctattttgttttttttttgaaaaccggaaaaaataccaaaaattgatagtttcgaccactctggctagactaccaaaattgaattttttttttcgaattgagaatggccgtggtctcatcagtagctagccattctctttttatttcaatttttaagaaaaaagtctctaaaattttgaaaaaatcgattttttttacttactttgatactttttttatatcttttcaaatcttaaaaaacaattttaaaaattgaattccggaaatttttttaaataatataaatctatagttttttagtttttaaaaaatatatttttataaaaatctaaaaagttcggcttttgacttttgaaataatcgaaaatgtttgttttaaattttgaaaaaatataaaaaattcgattttttcaagataaaaaagcgaattttttgaatttttttcaaatcgtaaaaaatgtctgtagtttttttaaagactctcataaaaatctgaaatgttcgattttttatttttaaaataattttaaaaaaattttaatattttttatcgtgcgaattttttaccaactataatttggaataattttcaggatctcaaaatatcccacaatcgcgcaaatatgccaggaagcaatgaagattggataaagaaggaggtcgaggaccaggacaccaacgccaacagctcgagctccagcatagccgtctcgcgtcagctcgaagggaattctgctgttcctgacgccatcgaccttctgtcttctcaaatcaaaagagaagttgaagaggaggatgatcgcaacgatgagactggaccccgttcggagcccgtggatgttaagccgtctccaaaacgcccaacgaagaggtcagccgagacctggacgacggctcggcgccaagcaagaaacggtctacggcgggagacggttcaactcatcgattcgcgtatgtgaatgttggagtccgccatccatacgatccacgccatcttgtcatggaaacttcattgaatgaaattaggtaaggaattattgaaaataattattatatatccattttaattcaattttttttttcagaatcgaagatttcgaaataatccagtatcttccgatgcccttcaggacttcgattcccatgaagctagtgatcttcgcagtgagaagtgaagaatctgccgagaagatccgctcgttaatcgatccttcgatgtggatcgcggcttttggtggcggaaccgaaactcaaaaattcttgtggagcgagctgacggtggaggatttcgtcaaggcacacataatggccagcaggtaagctttcgaacatacttaattttttaaaaactaaaattcagcgcaaccgatgacgtgccatatgaggcagccatggcggatcgagaatcgctcaaacaagctgtaaatgatgccagctctctgaaaggcttgaaggaggtaataatttagaaatgacagaaaatgaaccgtgatgacgaaatacatctgtaaaaaaattataaaaaattctaagctccgtttttaattttttttttcagttatattctgtcatagcggcctatttctctggaaaaaaaaatccaaaatagcctcaaattcggaattatgcttcgattttttttctgcggtagtcctgaatttaagacgattttgaatttttgtagctgcctttcgccacaattacgttaaacatttcagagcatgtcgaaagctggatggaggatcgtgagtaagatgcggaaagatctcaatggagcctgatgatccccttcccagcacacaagacagttttaattttgtgtctgtatagttttatattaagttttgatgataatgaatttttttacggttttatccatcacttggctcgattg