Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:337G7_2   

TH:337G7_2RNAiTH:337G7_2
PCR_productTH:337G7_2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS VB0393L.2 Source_evidenceePCR348WS150 Sequence/Annotation Release
B0393.8 Source_evidenceePCR348WS150 Sequence/Annotation Release
F31E3.6 Source_evidenceePCR348WS150 Sequence/Annotation Release
Overlaps_Gene VB0393L.2 Source_evidenceePCR348WS150 Sequence/Annotation Release
Chunk_score Abs_score259
Specificity_index0.251
Rel_score0.751
Map_statusTop85_percentile_ePCRIII47493954750194
B0393.8 Source_evidenceePCR348WS150 Sequence/Annotation Release
Chunk_score Abs_score259
Specificity_index0.251
Map_statusTop85_percentile_ePCRIII47518944752693
F31E3.6 (3)
F22D6.14 Chunk_score Abs_score167
Specificity_index0.162
Rel_score0.484
Overlaps_transcript VB0393L.2 Source_evidenceePCR348WS150 Sequence/Annotation Release
B0393.8 Source_evidenceePCR348WS150 Sequence/Annotation Release
F31E3.6 Source_evidenceePCR408WS150 Sequence/Annotation Release
WB_DNA_textTH:337G7_2800tcgacatccacacataccgtagttggtgacgttgttggcggcaaatcgcggcgagacccgctgtgtcgatttacgaggatatagctaatgttagtttttcccaataaacttggtttttctgtcgttcttgttcaattttcgtgatcttttcgcagtttttactctttttcatgtatatttattgaattcaatattgtacttttcaattctctgcgcagtcaaacgtcatttttagttttatagctattttcggtggcttaaagaaaaaaaattttaattttctttttcagagctcgatattgctccagtcaggatatgatttgttgatgtcgtcagcgcgatgaattccgtcacataaaatatgcacaaaatcgtcaataacgatcagaacaagatattggtcatcgcgtaagttcaaaaagtgaataactggattatgaatataatttcagaaagtcaaatgctcaatctctgcggaagacttttctacactcgtgccttctgaaaatgtcgctctctcagccttggtcgcatagttttgaaatctgtcaaggtatcccaaatggttttcgctttagtttcattcttattaaattatagaacacaatacgcagaagcgcatcagctattcacggctacatcgatcaattggacgtctccgtgtattcctaacagatgataactctatattgaaatcaacaaataaatttattaaaatgtatattttagtattttccacagttatcatggcacaatcatactcctgggcaaaaaaatacaacagtcgatttggcttgttc