Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:338G2   

TH:338G2RNAiTH:338G2
PCR_productTH:338G2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D3A.1 Source_evidenceePCR1034WS150 Sequence/Annotation Release
Overlaps_Gene Y47D3A.1 Source_evidenceePCR1034WS150 Sequence/Annotation Release
Chunk_score Abs_score929
Max_abs_score929Y47D3A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1113932211141003
Overlaps_transcriptY47D3A.1 Source_evidenceePCR1034WS150 Sequence/Annotation Release
WB_DNA_textTH:338G21682cgaaaacgtaattgctggggatataactttagagaaatatgtgaattagggtgatcatcgttttgagccatcaaaataactcctgaaatgaagtcctcaacgttgtcaggattcatgagcactttgcaaacttccttcgagagtttcaaagtgatcttgttggatgggaatatcgtgcgaacatttggaacaaaattgttaaatagtgatccatgacacttttccattattcttgtgagttttatattaatttccactacatccaatgtgtacattgaacgttgttgagtccggtaatccacatagaatttagcttttggatcaatataatcagtattctgatagaaatcgtcgttcgtcacatttttgaacccaatttcaacagtttttacattccattttgttattaacatatccacaagctctctcggtagagaatgtcccaattccttcttttcgaatatagatgttagaaaaattgtaaattttgagcaagtgatgatcgagttgataaagttttcaactagcttcggatccttctgcttgttaagccataataatacgtagagatctctgaaatgattaattgtgtaatgggctcgtttaagtggtgtcaggctgtcccataacggtttgatctacaaaaaatggtggcattttttcccaaaccatgtaaagtgggttaggaattttgcaactaaattctcgcgattttcgtggacactctaacaccacgcgtttgtttcgaacgttggctgataaaaattttaagagtttttccgtaattaccgtaaagtatgtagtaattgaaaatcgatcatgcataattttctcagcgtcggaattttcaaacggtttagtactttgtaagtgggtagtattacatatgcacgtggtgtcaaactgcccaattctggtgtgatcaacaaaaaatgcgggaattttttgcagaaaaaaatgtgacgtcagcacgctgttaaccatacgaaatctgttgagaagtctgcgcctcttctcccgcatttttggtagatcacaccgaaattgggcactttaacatcacgtgcctatgtatataagtttatacggttctcaaaaattttagaaaaattctaaaactcactcgtctgtgatctgtaatgcatcaaagcttcgtttttgccccattacactttgaaatatgtccagttgaattggcccgtatactttacagttttgaatcatttttctacattcgccacatcctgcaatgcagatattatcaactccaataaattcttcgactctctcatctgaaagtaagaatattagaaaattaagaatggatcaatagaactcacaatctgaatctgtaaataagtcattgagagccaaatgaataatttctctatcaatacaactgaattccaagtcttcaattattattttgaataccgttatcttcatcgtttgtttcaagaacctgtaatataaatttacatactcattttcataacaaaacttgcctcgcatactttcgtatgttcttaacattaagctctaccgaattcaagttcactgtacaatttgggcatcttctaataatatcacaacgagtaggcttgtgaaagatcactgtttgatgctctattcgaatcgaatgaatgattccaaaattgaatgctttgttgaccagctgcaaa