Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:339F1   

TH:339F1RNAiTH:339F1
PCR_productTH:339F1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y49E10.23a Source_evidenceePCR693WS150 Sequence/Annotation Release
Y49E10.23b Source_evidenceePCR693WS150 Sequence/Annotation Release
Overlaps_Gene Y49E10.23 Source_evidenceePCR754WS150 Sequence/Annotation Release
Chunk_score Abs_score649
Max_abs_score649Y49E10.23
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1247265712474283
Overlaps_transcript Y49E10.23a Source_evidenceePCR754WS150 Sequence/Annotation Release
Y49E10.23b Source_evidenceePCR754WS150 Sequence/Annotation Release
WB_DNA_textTH:339F11627ctccaaatgaggagcatgtgctcattttcagaggggagaaaccttcttaacttttttttgtgtttgaggactcatcacaaaaaaattttaatttcagactttcaatctaaatgctcagaacttagtgttaatccaaataaaatttctgttttaaaaaaatggaagaagacgtagtggagtcgtgtgaagcaacaccggtaagttttttattttatttgtattattattaaatttttcaacattttggcgttttaactgaagttcgagaatttaaaaaaatttaaattttatttttgaactgttaaaaaaataatatagtaaagttataactatatatatacaacactatatatactatataactatatatatatatacacctttttcccagacaaattccacatatggaacacctgttcgtgtagcatcgccccttattcataacgaagatgacgtcatcccgacgactgccgtggaaaattccttatactcgaaatgtaatgcagtacaggaacaagaatttgagaggtttgtgggaagttttttttgtggaaaaaaaaatttaaaattgcagattagagtcgcaaaatgcagaatatcgagaaaagctgctgagaacaattcgagaacgggatttgaatgaggaacttttgaagtaggttttccgaaaaatgtcgaaaataaaaattcgtaagcatgaattttgatgtaaaattttcagttttcaaattttgcagtgcggaaactgtagataactttttcgcagctcaattaaaaaataactttcaaaaattgttcgaattatatttttttaaggttgtgtctaaaacatgtttctaggcctaaggcttagcttaagcctaagcctaagccgaagcctaagcctaagcctacgccttagcgtaaacctaatcctaagcctaagcctacgcctaagcagaagtctaagtccaagactaagcctaggcctaagaataagcctaagcctaagcctcagcgtgagctgaagcctaaacctaagccttagcctgagcataggcaaaagcctaagcctaagcctaagcctaagactaagcctaagcctaaacctaagcctaaactttagcccatttttgtttgcagaaatgttcaaaatcagcacaaaaaagagttggatgctcaagtgcgaagaattcgagaattagaagttcaactcaaaaccacaacggacagaggactggctcaggaagcacattttaatgtgacaactaaagaaatgtcacagaaatttaatttggctcttcagcaggtattttttttgtttttttgatgtacaatttttcagcaattttcatttaaatatgggccacaatttcaggccacaaaaaaagccgaacaatgtgataaggaaaagaacgaagcggttgtaaaatatgcaatgagagaaggagaaatgatgaagttaagggacgaaatttccaagaaagatagtaatatgaaagtgatcaaagaggaattggaagctgcaaggaaagcacagagtcaggaaaatttggatgatttggagaaaaccgtgcagaacttgaaagtcgagattgaaaagttgaagcatgaacgttttgattttgaaaatcgaatgaagattgcc