Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:340A6   

TH:340A6RNAiTH:340A6
PCR_productTH:340A6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST16G12.1 Source_evidenceePCR731WS150 Sequence/Annotation Release
Overlaps_Gene T16G12.1 Source_evidenceePCR731WS150 Sequence/Annotation Release
Chunk_score Abs_score631
Max_abs_score631T16G12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1004647310047483
Overlaps_transcriptT16G12.1 Source_evidenceePCR731WS150 Sequence/Annotation Release
WB_DNA_textTH:340A61011gcttacttaattactccaattagttaaaaacacttacatcagttaaggtggagaacaagtcaaaatcatttgcatttgagtattgcatcttttgtaaatatgctcgaattccttgtttgaaaacatcagctcctagaacatctgaaagcattcgaagcattgaagctcccttgttgtatgtgatatcatcgaatgcaggtccatccggataaactaatggatgagcatcatatcggacgtctgcggtgagcccaacttgaagctcgtcaagcacttgaagagtgtcctgaaatcgaataaactttgcatttgaagaggaacagattatcaatttgtaaaagttatttaaaatttttctaattttagatatacgcttgtggagatttacgataagcagatttctctgtcagttttaaaatttattttgaaaaattaatgtaaaatcttgttggtgtcaaatatgagccaacagtctaaaatgaaactgaatctaggattgaatcccaaaaacttaccaaataagttgcttgctgtgggtagacagatttttgtataaaagtcataaaataatcagcgaatccttcattcaagaacaaatcatcccaccacgcagttgtcacaagatctccaaaccattgatgagccaattcatgacacataactttagcagctgcttccatatttctcgtcgtcattgtctaaaatcccatttttccatttcattttctacattttttcaatagaaataccgttggattatacgcaatatattggtatttgtagattatcaatccccagttctccatagcacctgccaagaattcaggcattccgagttggtcagcctttgagagtgggaatttaattccagtatactctcctaattggtacaagcattctccagcattttgagcagcgaactgaagatattgttcagttccaggccatccccatgctcttgtcaaagtgttatgcttattgacatattgagaattcacataaggccccact