Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: TH:340C8-R   

TH:340C8-RSequenceCCTCGCTCAACTCCAATTTT
Length20
In_sequenceF20H11
PCR_productTH:340C8