Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:340E12   

TH:340E12RNAiTH:340E12
PCR_productTH:340E12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS H10E21.3a Source_evidenceePCR640WS150 Sequence/Annotation Release
H10E21.3b Source_evidenceePCR694WS150 Sequence/Annotation Release
Overlaps_Gene H10E21.3 Source_evidenceePCR694WS150 Sequence/Annotation Release
Chunk_score Abs_score631
Max_abs_score631H10E21.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1349014750
Overlaps_transcript H10E21.3b Source_evidenceePCR694WS150 Sequence/Annotation Release
H10E21.3a Source_evidenceePCR640WS150 Sequence/Annotation Release
WB_DNA_textTH:340E121261tccctactgctcgttcactgaacaatagcctccttctctcaccgagcttcatctcttcccgtatgaacagggtgagcacatccgggcccgctgagcagggagccatcggagatggtccgggagtactgtagtttgtagttgttgaggcgctgaaggaggtggacgatgagattttccgaggtgtaggggttttctggaaaaaattgaggaatgttaaattttgaaaaactaaatttttttaatgttcaattttcaaaaattttaattttggcaatttcaatttttttctaaattttttaaacaaattttctgtaaatcttactatcacaaattcattatcctgttccaagtcctccaagctatttggctcctgaacctcaattttaggaaccttaaccccctccaccacgagcttctgctcgtcagccgtctgcggggacacattcgcgaatttcttatttctcttgagccctgattttgtgaaaaatgctcttccggtttcaatgtttggctttttgggttgaactccaccgggcttcatcccattgctcaggcactttttgtgacggcagcttctgcagatttggtgcatacctggaatgaaattttaggtttatgcaaaaaatggcaatgaaaacttatagaactttaaatttcacacattttgttggtttacaacttttttatatgcctactccatgtggagttatgcctcacaaaaaaatggactaaaaaccattttaactttaacataaatcgatagaaaatcaaattctacacatttccgcataaaaatttttcttgatatccttactctccgctgagttacgccgtctcaaagtttagacaacgagagagtgtggtggagggggagacgccggcagcgcgcgcgtctcgcaccctcctcccgccccacactctctcgcctagcaaacttcaaagaggaatatctcggcgaggaggagagctatcagaaaattttaaaatgcaaaaatgcgtagaattttgagatctacaacactagcaacttactataatgaacattgcagtcatcccttcctgtgatgcacttgaaactttttgtcagtgcaacggtccgccggaaaaatgcagcacaagctgagcaggactgagcttcaaagtgaaatccagtggcttgtgctgaacaaattagacatcgcgtggagctggaagaagctggaaatcggaattttgattttacagttttttttctaatttccaaatacctaccttccgccgt