Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: TH:340E5-R   

TH:340E5-RSequenceTCCGTTTTCGTACTGCAACA
Length20
In_sequenceK03H1
PCR_productTH:340E5