Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:340c12   

TH:340c12RNAiTH:340c12
PCR_productTH:340c12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF35G12.8 Source_evidenceePCR770WS150 Sequence/Annotation Release
Overlaps_Gene F35G12.8 Source_evidenceePCR770WS150 Sequence/Annotation Release
Chunk_score Abs_score707
Max_abs_score707F35G12.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII45877964588654
Overlaps_transcriptF35G12.8 Source_evidenceePCR770WS150 Sequence/Annotation Release
WB_DNA_textTH:340c12859cgacccgatttccttacaaaaccgaatcgggcggatcgtttgatgattcgcaatgttgaagtggacaatttcaagagttacttcggcaaggcttccattggaccatttcacaaaagtttcacatcaattatcggtccaaatggatctggaaagtctaatttaatcgattcgctcttattcgttttcggtttccgtgcttccaaaattcgttctgcaaaagtgtcaaatttgattcacaaaagtgctggaagaaatccagacaaatgcacagtcactattcattttcagcggatcgtcgatattgtaagtgaatcagagaatctaataaaatataaatttgctttttttcagcctgggcattacgaagtcgtcaaggattctgagttcacaatctctagaactgcttttcaaaataactcaagctcatatgctatcgatggtcgaccggcaacgaagaatgaagttgaagcacgcctacgacgcgttgacattgatattgagcataatcgttttctaattcttcaggtaaaagtgacaataaaaccggtaataaacatttttttcagggagaagtcgaacaaattgcaatgatgaaaccagtgaaaaccaccaaaagtgaaactggaatggttgaatatttggaggatattatcggaacaaaccgactcgagccctttgttaaattattccagcgacgcgtcaatcgtcttacttgtgatctttctcaacaaagaatcgctcgtgatcacgccagaaacagcaaagtagctatggagaatccagttagagctgcaattgagtttctgatgaaagaaaacgaggctacaacgattcatatgaaattggagcaaagaagacg