Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:340h12   

TH:340h12RNAiTH:340h12
PCR_productTH:340h12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05D11.3 Source_evidenceePCR424WS150 Sequence/Annotation Release
Overlaps_Gene C05D11.3 Source_evidenceePCR424WS150 Sequence/Annotation Release
Chunk_score Abs_score382
Max_abs_score382C05D11.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64321216432587
Overlaps_transcriptC05D11.3 Source_evidenceePCR424WS150 Sequence/Annotation Release
WB_DNA_textTH:340h12467gccgctaatattcaacagcagtttggggagcagcttttacgagcagctcaagttgtcgaggaacagatcgaccaggagatgaataagtaattttgaaatgtagaaactgtttgtcatgtgtgtttttagacttgagaacctagaagaagacgatcttgaggtaattcgtcgtcaacggatggaacaaatgaagaaagctcaaaaagacagaattgagatgttgtctcatgggcacggaaaatacgaggaagttgctgacgagaaggagttcttcgaagctacaaagaaaagcgataaagttgtctgtcttttctacttacctggaaacttccgatgcaaaattgtggataagcatttcgagatcttggctagaaagcatgttggaacacgattcatacatgtcaacgccgagaaggttcatttcctgacaactcgtctcaatattcgtgtcattccaagcatcgcta