Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:340h5   

TH:340h5RNAiTH:340h5
PCR_productTH:340h5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06H7.1 Source_evidenceePCR319WS150 Sequence/Annotation Release
Overlaps_Gene K06H7.1 Source_evidenceePCR319WS150 Sequence/Annotation Release
Chunk_score Abs_score277
Max_abs_score277K06H7.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII80996638100026
Overlaps_transcriptK06H7.1 Source_evidenceePCR319WS150 Sequence/Annotation Release
WB_DNA_textTH:340h5364tacaagtcgactaggaaaaatgaaagatctccaagttccggagattgaaatttcaggagttcttttggaaagattggaagcttgtaattataggcttgacgagctttttatagacttggtagttaaaaaattaatctgaattccgcgtattttgatatttcagaaagcaagcaaatgtatttgtagttcgaatgagcttttgaacattccaaaaatcatcgttagaaggctttttctaaaaatggaatctctggaaatgttggagtggtggattgaaagagttgatccgaactctctaaatgagctgtgtattgctcctcatggagaatatccacttgatattccgtccaagatatttgatctt