Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:341A4   

TH:341A4RNAiTH:341A4
PCR_productTH:341A4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G7.11 Source_evidenceePCR408WS150 Sequence/Annotation Release
Overlaps_Gene K04G7.11 (3)
Overlaps_transcriptK04G7.11 Source_evidenceePCR408WS150 Sequence/Annotation Release
WB_DNA_textTH:341A4455tgtgtcagcagttgggtaaaactgttcccctccaacgcattctctcatctttttgtaagaatcaagatctggatcaagagcagcagtcaggcgagtatgttgacgaagagtcatatcttcgtaagaagtaaatccttgatctgggttcttctttctctttcttttttgctcaagcttctcagtaacatctgcagacatctctaaactgcgaacacgttcatagtccaatcccttgtcttctgcagcttttcgatcttgtagctctttaacctgccattgatctctttccttttttgcttcgtggttttttggaagtttgctgcgacgatcttcttcaacgacctacaattttaaattataattgaaaatgtaaacgttaaaacactaacctgttcgtgattctcttttctcgctctttggcggagtttgtgaagatcacggaacctctgattgaa