Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:341D7   

TH:341D7RNAiTH:341D7
PCR_productTH:341D7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene T20H4.5 Source_evidenceePCR421WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII72330517233584
Overlaps_transcript (2)
WB_DNA_textTH:341D7534ggaaaagcgaaaaagctacgaaaaaatcaggtattttaaaatgttctcttctcatttcccacaattcgtattatcttaacgataaagatattcggcttgaagattggaagcgagctcaggctcccagcgatcaccattcaacaagagcttctccttattatagaggagttcttcgtgagtttcagtcgaatattcgaagttcgggccctcgacaattgcatcgactgggcaagcttcctggcataatccacaatagatgcacttggtcatatcgatatcgtatctagtggtacggcgacttccgtcaggtcttgtttcggcctcgatcgtgatagcttgagctgggcaaatggcttcgcaaagcttgcaagcaatgcatctttcttcaccagacgggtatcgacgaagagcgtgttctcctctaaaatactgatttttttgttaataatttttgtttttttttaaattaactaaataattaatatttttaattaaagaattttcgaatatgtgtcgtgtgaaggtgcaagtttg