Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:341G2   

TH:341G2RNAiTH:341G2
PCR_productTH:341G2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC16A3.8 Source_evidenceePCR904WS150 Sequence/Annotation Release
Overlaps_Gene C16A3.8 Source_evidenceePCR904WS150 Sequence/Annotation Release
Chunk_score Abs_score862
Max_abs_score862C16A3.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII63694756370606
Overlaps_transcriptC16A3.8 Source_evidenceePCR904WS150 Sequence/Annotation Release
WB_DNA_textTH:341G21132acgcaaacgatttccttcactacagtaatccaacttcaagaagacgaggatataaaattatctgaagggtttaatgaggaatatgttctctcatcaaatcagaagcttggtttaacgtgtgcattattagaaagtggaaactggaaacaagctcaaatgctcattgatcgtctcccagaatactatgcagttcaagctagtccacgactctgtagagctctttgcaaaataattgagaaatcaattaacgatttttacaagaaaaattgttcgctgaacttgtttggagatttgataaaatcgacgaaaccagtgttagatgatatgggaaatggattaagaccaatcgaaagttgggaagatcttggaaaattgtcaagtgtacttgcctatttgggacctagaatagcctttcgtgcttcaacaaatatcaaaattgttcgacttttgactgcctactaccgaaaagttgacaaggatctgctaccgaaggatgataaacgtaggtttttttcaaatgtgaaattttgcgattttcgccccgatattaaggttaacaaaacattttgaaaaaacgataaaaactaggaaaaattagttcgtatctacagaactccttgtacttttgtacttttttaaaatttatgtaaatctgtcacttcgagatcgagcaccgtatttttgaagaaaaaaaaacaaccattttcaaaattaaatatcattatttcagtaaatcaaaatttcgtggaagtcgtctccgaatgtcttctaccatctctcacactgtccgaaacaaatgttgcacttagtgaagagatttggcagctccttgagcttttcccgtattcttggagatattggatgtattcaaaatggaatcttgaaacttcaagacatccagaaatgcatataatgaaggggaaaattcatggacgaacaaaatatgttctgaagcgtctttcgaaggaaactgtaaagatgatgggcagacaattgggaaaattgtgtcatatacatccatctacagtactctcatatctcctcagtcaagtgcaaacttttgataatttcattggacctgttgtggatagtttgagatatttgacaagtcttgaatttgatgttctcactt