Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:341c10   

TH:341c10RNAiTH:341c10
PCR_productTH:341c10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC29E4.2 Source_evidenceePCR1272WS150 Sequence/Annotation Release
Overlaps_Gene C29E4.2 Source_evidenceePCR1272WS150 Sequence/Annotation Release
Chunk_score Abs_score1230
Max_abs_score1230C29E4.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII79418237943143
Overlaps_transcriptC29E4.2 Source_evidenceePCR1272WS150 Sequence/Annotation Release
WB_DNA_textTH:341c101321gcactcgccggatacctcgaggttatcagacaagaaagtgaagacacagataatcaggtggatgcagcgacaacttacagattgttcgattttcaacgagcatgccggattattcaaggatcgtgtgccgtatatggtcgaaaagtagatcatgtctatgaactgacgatttcagttgtggatttagtcgagaacaaaggtcaagatgatggaaacaccggcagtagacgaggagctggaagacggaaaaattttaatttgggatcgacgaattacgacttggctgatatcgactcactgaaacaggaagctctagcaaattttgagaagacagtaaaagaagagaaaaaatcgattgatgcagtgagaatggtcgagaatgctgaagttatagagtctcaatatgagcgaaaaagctgtttagtagcaaagccaacccagttcatgttcaagctcaattacggccagctcaatcgtactgatgaacaaattttgaatgcaaaatctcgtcctgatgttatcggaaaagtaaaagattttgaaattaaaaagtcgaaagttaaacacgatcaacaaatactctactcccatgattgttatcgtggaaatttagaccaattcacactacctggtgctcgttggatgccagataataaggaattggcagctaattttggtgttgctgatttggaagttgagttagatttggagcaagagcatgagaagatcagtgcatatggaccgtttaaggtaagtggtaataattcgatgaaacattttcaaaacttgatttcttcaggatcctctctctggccgtgaagttgttccacctcctcgttggttcatagagcaagaagcagttcgtcaaaatcaagaaattcaatctcgtgccacatcgagagccatcacaattgcagctaaaactcttcgagattctcaaggctttggatctcaaccaactcgtctctcacaaccatttgttgaacgacatcgacagagtaatcatttgaatgatttcttgtcatttgtggagggaagagttaataagaatcgcccgagcactcatcttaccactggcttagttgatatgttcgttgataactttggatctgttatgcaaaacgatgaaccaaacactagtagaagacctgatgagaattacgcgcccatggactttgatgatgattttggtggtggaggagacgatgacgacgatgattatattcgaaatttgtccagaagggatgagaagcgagcaccggcaccatgggacgagctggataaaaatcatattatttggtacacgggagacgagaatctg