Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:341c12   

TH:341c12RNAiTH:341c12
PCR_productTH:341c12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene Y56A3A.20 Source_evidenceePCR793WS150 Sequence/Annotation Release
Chunk_score Abs_score751
Max_abs_score751Y56A3A.20
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1191907411919918
Overlaps_transcript (2)
WB_DNA_textTH:341c12845ttgtggaactccgattaggccttgtggtgtctcatcgcctagtcgagaagttgatccggagctatggaacagcgaaagcgaagatccaagaccaaacatatgtccacagatcaatggagcaatctggttccagttgtctccgaaaaactgctttttgatcttgaaaaacgtggcggcggtcagcagtgcgtcggatccagcttgatggcgaactccttgtcgtttcacgtccagctgatcggcgacctcttgaagtcctcctttcagctttgcagacgcgcaatttggagttcggagcaggattttgatgtcgaagctggttgggaagagagttttgtggcacatgaagaacgttgactcttccttaggcagatctccaagtgtgatgcttttcaacaaatatccaaagtcgtagccggaagagaacgtgagccatgtgatccgtggatcagtgatgaggcctgacgtcgtcaaaagttctccgaatactgctgtcggtattccattgttctggaagaaagaaattattattaaaatattggaaaatcaatattaaaaaaacctgcagcaatgtgaagtctattccggcttgccggagcatttcgacactctcatgcgagaacatgtcttcagcgaaggagaaattgaaattgaactgccaaacatcgccagtcggtggtagctctcctttgtcattgaccattgcaaagcccacttgtattaatttcagcatattcacattacagaacacttgctgataattgaaatcttccttgcttcgaaatgtgcccaacggtgtcgccacaactccgggaaattctgtgtccattgccacgtagggataa