Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:341e1   

TH:341e1RNAiTH:341e1
PCR_productTH:341e1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K10D2.6 Source_evidenceePCR518WS150 Sequence/Annotation Release
Chunk_score Abs_score476
Max_abs_score476K10D2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII51969285197489
Overlaps_transcript K10D2.6.2 Source_evidenceePCR518WS150 Sequence/Annotation Release
K10D2.6.1 Source_evidenceePCR518WS150 Sequence/Annotation Release
WB_DNA_textTH:341e1562tgaccacacatcagcttggtatctttttgtcttctccatatctttgaagtaggcgacagcttccgtttcagattttcctccgatttctctgaaaatcttctgaagtgttgcctgaacgtcacgagccatgttgcgggcgtctccacaaatgtagacgtgagctccaacgttaatagcatcccagatacgatcacgagtctcccacaagcgatcttgcacgtagatctaaaaatatcttatttaaaagtcaatgaaacacggtatcctaccttatgttcctgagctctggagaaagcgcaaaccaagtgtgtgagcacttcgtcttcttggaactttgccaactcatctttgtagatgtaatcatgatctggatgacggcatccataatacaaatgcattgctccgatttcctttccggcatttttgtggaattgacgatcttggaggaatccacggaatggagcgaatcctgttccgggaccaatcataatgacttgagttgtggtacggtggggaagacgcattgttgatttacgaacgaaaactggagatttcgatccgg