Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:341g3   

TH:341g3RNAiTH:341g3
PCR_productTH:341g3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C07H6.5 Source_evidenceePCR905WS150 Sequence/Annotation Release
Chunk_score Abs_score863
Max_abs_score863C07H6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII74965997497548
Overlaps_transcript C07H6.5.1 Source_evidenceePCR905WS150 Sequence/Annotation Release
C07H6.5.2 Source_evidenceePCR905WS150 Sequence/Annotation Release
WB_DNA_textTH:341g3950ggtgagaagatcggagcaaaccaagtttctgcagtttccttgacggaagtcatggaagacacggtttctgtgattctgagccatcttggaatgaatgtagtagcacgagtaaccgatttccgtgattttcttagcgagaagctcaacacgttgagtagagttacagaagatgatcgactggttgatttgaagttttcggaacaacgtattcaaacagtggaccttttgcttctcttgaacaaaggcatagtattgggtgacaccaagaagagtaagctcctccatgaggttgatctcatacggcttgtgcatgtgcttctgcatgaacgaagtgacggtgttagggaaagtggcagaataaagcataacttgacgctcctttgggaggaagttgatgaggcggtcgagaattccctgtaaacgagaattgttatcttattcaaatgttaatttttttacctggaagtcttgactaagaagtttgtcagcctcgtcaagaacaagtgttttacaatgttccattttggcgactcctttctccataagatcgagaattcttcctggggtggcgatgaccaagtgaaccgttccgtttagacgcatgatatcatcacggagatcagttcctccggtagtgaccataactttgagctgaatgtgtttggagagctccacgcagatctgtgaagtttggagagccaattcacgagttgggacaatgaccatggcttgaatagctttgagggctggctggatcttctcgataacagggatacaataagctccggtttttcctgttccgttcttagctcttgcgagaatatcttgaccagtgagagcgactccgatggatgcttcttgaataggactcggtttttcccatcctttctcaaaaatccccatgagaagatcgcgtccaaggcagaaatcctcaaactcgactcccttcg