Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:341h8   

TH:341h8RNAiTH:341h8
PCR_productTH:341h8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK328.5b Source_evidenceePCR1344WS150 Sequence/Annotation Release
Overlaps_Gene ZK328.5 Source_evidenceePCR1344WS150 Sequence/Annotation Release
Chunk_score Abs_score1302
Max_abs_score1302ZK328.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII60145506016015
Overlaps_transcriptZK328.5b Source_evidenceePCR1344WS150 Sequence/Annotation Release
WB_DNA_textTH:341h81466tccaaccgaatagagcaagctccatacgtgccattgaaggaaataatcgttgggattttctccagctgcacagtcaagtacaacttccactgagtgctgtgattcacatgccaatttgatgagttctccgggcagatctccacgattagaagcggcacggccagcattgacatctttctgataagcatcgtaagattcttctagaccagtccatgcacgaagataccagacatgcaaaccgagtgcttgaatccaattgagtccatcaagacagttgatcgaatgattctttccgtcttgatcccattcgtagtgtgatagtcctgacatcagaacatagcatttgagagtttccttcggaatcaaatgaagagtttcgcatttcttccagttgtcaagttgtgctttaaagcaatgaacagtagcttctgggcacacagcagaagtctgaagcatcgtagcaagctgtggctgattattatcaatcgcaatttgaaaagctttatcgatgtctccaagacagagttgattccaaacaccatttgaagatgtatccgcacttctatcgtctggaacagacttcactgcttctgttctaagccattctccaatttcttcaccacgctcgaaagaccatccttctcgacgttcatatgggaatagagcagatatcaacttccaaacagaaacatgtccatcatatccaccagcttgagcgacatcgatgtacttggcaaacatggatgaatatgagtcagaataagtgacgaagttagaagtgagcgaagatttaaccgagttggattgtgaagatggacccttgcgactggtttcagatacatgaacattcacatcaagcattgagattagcgtgttctgaaaattgattaaattaaaaatgggccatagaagagaacggtgtaaaaaagtacttagaaatccaattgacaaatagactgtaaatcacagaagggcttttataaagtcacaaatattacctcattcacgtccgatgttctatcaattgtcccaaagagtacttgattgtgtcggggttgagctgaccacacaagacatccagtttcactccatccgacatgtgaacttcttcccttcacaattcctatatcaatcagtttgctctttccatatccaatcattttagcagagtgtccaccaccgtggaaccgatgagctgggtcgttggccttcggcatgactttcagttcctggagattgcgaatgaatcgactgctttcgtattccaaatcagcgagaagttcaagtttcggcttcttttccggctgctgaccttcttcaataattgaatcatgaccactttcattgaattcggtggtcatatttccgatgcatgattcttctcgactatcatccaatgttccaccaccaagaccttttcggttaacacgacgaatgatcggcacaacatcacctaatgcagcagg