Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: TH:342F1   

TH:342F1RNAiTH:342F1
PCR_productTH:342F1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC34E10.2 Source_evidenceePCR475WS150 Sequence/Annotation Release
Overlaps_Gene C34E10.2 Source_evidenceePCR475WS150 Sequence/Annotation Release
Chunk_score Abs_score433
Max_abs_score433C34E10.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII52589915259512
Overlaps_transcriptC34E10.2 Source_evidenceePCR475WS150 Sequence/Annotation Release
WB_DNA_textTH:342F1522tggctgaaaaagctgaaaatcttccatcttcttcggccgaagcttcagaagagccatcacctcaaactggaccaaatgtgaatcaaaaaccatcgattttggttcttggaatggctggttctggaaaaacgacatttgttcaggtaactttcattcaattttgagagttttcaaacattactattttcagcgtctcacagcattcctacatgctcgtaaaacacctccatatgtgattaatctggatccggcagttagcaaagtaccttatccagtgaatgttgacattcgagatactgtgaaatacaaggaagttatgaaagaattcggaatgggaccaaatggagcaattatgacatgtcttaacctgatgtgtactcgttttgataaagtaattgagttgattaataagagatcttctgatttctcagtttgtcttcttgatactcctggacaaattgaagcattcacttggagtgctagtggatctattatcactgattcattggcaagtagccatcc