Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: WBPaper00024346:F44F4_1.1   

WBPaper00024346:F44F4_1.1RNAiWBRNAi00038545
PCR_productWBPaper00024346:F44F4_1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF44F4.11 Source_evidenceePCR1004WS150 Sequence/Annotation Release
Overlaps_Gene F44F4.11 Source_evidenceePCR1004WS150 Sequence/Annotation Release
Chunk_score Abs_score941
Max_abs_score941F44F4.11
Specificity_index0.875
Rel_score1
Map_statusBest_ePCRII1091882510919881
C47B2.3 Chunk_score Abs_score68
Specificity_index0.063
Rel_score0.072
Y19D2B.1 Chunk_score Abs_score66
Specificity_index0.061
Rel_score0.07
Overlaps_transcriptF44F4.11 Source_evidenceePCR1004WS150 Sequence/Annotation Release
WB_DNA_textWBPaper00024346:F44F4_1.11057tgtggatcttgagccaacagtcgtcgacgagatccgcactggaaactacaagaagctgttccatccagaacaaatgatcactgggaaggaagacgctgctaataactatgctcgtggtcactacaccgttggcaaggagctcatcgacactactcttgacagaatccgtcgtctcgccgacaactgtagtggtcttcaaggattctttgtcttccactccttcggtggaggtactggatccggattcacctcactgctgatggaacgtttgtcggttgactacggaaagaagtcgaaactagagttttcaatctatccagctccacaagtttccactgcagtcgttgagccatacaactcgatccttactactcatactactttggagcactccgattgtgcattcatggttgataacgaggcgatctacgacatttgcaagcgaaatttggatgttgaccgaccgagttacaccaatctcaacagaattatctctcaggtttcgcaaaatacttgttttaatgtatcctatgtgtttccttttcttttcaggttgtgtcttcaatcaccgcttcactcagatttgacggagctctcaacgtggatctcaacgagttccagaccaacttggtgccatacccaagaattcatttcccattggcctcttacactccattgatctctgccgagaaggcatatcacgaggctctgtctgtcaatgacatcaccaatagctgcttcgaaccagcaaatcagatggtcaaatgtgatccacgcaacggaaagtacatggctgtctgtcttctgtaccgcggagatgttgtgccgaaggatgtgaacactgcaattactgccatcaaaaccaagagatcagttcaatttgtggattggtgcccaactgggttcaaggttggaatcaactaccaaccaccaactgtggttccaggaggtgatcttgccaaggtgccacgcgccgtgtgcatgctctccaacactacggctatcgccgaggcctggtcccgcctggactacaagtttgacttgatgtacgccaagc