Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: WBPaper00024346:F58A4_1.1   

WBPaper00024346:F58A4_1.1RNAiWBRNAi00038544
PCR_productWBPaper00024346:F58A4_1.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F58A4.8 Source_evidenceePCR1206WS150 Sequence/Annotation Release
Chunk_score Abs_score1080
Max_abs_score1080F58A4.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII96266449628992
Overlaps_transcript F58A4.8.2 Source_evidenceePCR1206WS150 Sequence/Annotation Release
F58A4.8.1 Source_evidenceePCR1206WS150 Sequence/Annotation Release
WB_DNA_textWBPaper00024346:F58A4_1.12349gcattgcatcgtccatcatatccagcgagaaattgtcaatcttttcaaacttgtcgatgaaggctctctttgatcgtagtttgtcgtatttggagagaagcgattcgaataacggagccacgcttgtgctgttattgagcaagagtccagatactttgtattgtggccgaacatatggagagagtggagcatgcatcattcgaagtggtttaagcatgtagaatggaggccttctgattgcgaactgaaatttgattttattgatttgatgctttaaggtggattatagaaaaataacgaaaaaaagtcattattaatcactaattttgtctttaaaatagtgattttattggtgcatttttgattttctgactaatgtgttatttgaattgccacgcttttgtcaaatttccaagtttctaaaaattttttacttcatgtcaaaaatactttttaaaaaagtttgcttcacaattgctgattcgtcaaaataagcgctcatttttgcaatgtaatttgaagatttttttcgtttgcagtatctcggtatttgtgaccgccttcgtgttttgagaataaaatctacatctccaaaattagcttacgaaaatttttcgtttttccgatatctcgaaaaatattttttaaagttgcttatttttatttttagaaaatatttatatgctttcttatagttttcatgaacataaacaaaatttgataaaaattgaattttatggttgatttagtaaatttatttttcaattttcccggaaattctttaaagtattgagcttacatcaacgttttgctcagcagtcataattgtatgtgcctcaatttgtccttgaaggaacatgtaagctgatagcatgcagtcatttggccgaacccgagaagcagttgaaaccatcattgaagttggttttaacaagaagcgagtgacgtcagcgactgaagtttttcgggtaaagttctcatttggatcgacaacaggagagatagctgcaaaaaacaaaataaatagataaaataacatatttcggaataaaaacaaaccggattgaataaagtgcattggtggaaacggagccaaatccaaataccgaattgatgggcacattgcagagttgaatcgatatggagcagtggaagtgctcatgattcgggcgacaagagaattgatatgatcaaatgttggtgtatctgttttgaattttccagccgcaagacggtgcagtgcagcattatcgaggacaacaacatgatctgaaaactatttatttgaaattccttttttttattattactcagatacaaaaattgagacggtacccggtctttttcacttaatgcgaatatatgtgagccttttaagggtactgtaatttcaaacgttcgttgttgcggaattttcatagatttttcgataaatcattgtcatttcgtttttaatttattaacttaccaggattctcaataagtctttgcatagaaagtacccagttatatggatgaacaacaacgtcagtactggtgtcactatttgcaaaaacactgtaagtttgaataactttcttcggaaatgcttcgcgaagcctttcgagcaagagagatcccgttccagatccagttcctccagaaacactatgagtaaatagaattccatccaaattgttcgtattttcagcctctcgaatgatgatatccattatcttctcttgaacttctcttaaatattatttatcattgattttcaattaaagaaatacaactcactgtccttgacaatatccacttgcccaattatttccagcaccacctccgtgatcggacatgaatatattgtccgtattgaaaagattcgaaaagtttggagactgcatcattccgttgattacacgaggttctagatcgactagaactgctcttggcacataatgatcgtcatcagcctggtagaacaatagatctttcttatcattcatatcgtcttcgtgagttgtttgtccacgtctgaaaacgaaaaaaattgttatatttatcaaaattatgaggctgaattatgaccttgaataaattgcgtcttaaattatttaacttagcaaaaatgtttgtttcatctcaaacaaaagtaaaataattcatattttgttttcaatcatgtcgattcacgagaacaattcacaattgcagcatttcagtattgaaatataaaaattgcaatagttttcacatttcggactgtggtatatcgaattttgcctaattgaaattgtcggtgcctcaaatttattccctactcattgattccatgttcgtcgaccatcgatttccagaaggcttgag