Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:117-c3_T7   

cenix:117-c3_T7SequenceGCCTGGTTTGCAAAAAGAAA
Length20
In_sequenceC06E7
PCR_productcenix:117-c3