Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:12-f9_T3   

cenix:12-f9_T3SequenceCGTTTTAAGAAGCGCGTAGC
Length20
In_sequenceF26B1
PCR_productcenix:12-f9