Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:120-a9_T3   

cenix:120-a9_T3SequenceGCTCAGAGTTGCGTGGTACA
Length20
In_sequenceC25G4
PCR_productcenix:120-a9