Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:123-e4_T7   

cenix:123-e4_T7SequenceACCAACCCATCCTTCCTTTT
Length20
In_sequenceF26B1
PCR_productcenix:123-e4