Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:145-c8_T3   

cenix:145-c8_T3SequenceGTTGCTGAGCGTGCTGTAAA
Length20
In_sequenceB0334
PCR_productcenix:145-c8