Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:146-h9_T3   

cenix:146-h9_T3SequenceCCTTGAAATCCACAAGCCAT
Length20
In_sequenceF07F6
PCR_productcenix:146-h9