Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:147-c7_T3   

cenix:147-c7_T3SequenceCCATTTCAGCTCAACAGCAA
Length20
In_sequenceF26B1
PCR_productcenix:147-c7