Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:161-a2_T7   

cenix:161-a2_T7SequenceGCCCATTTTTAGCCCATTTT
Length20
In_sequenceF26B1
PCR_productcenix:161-a2